Сайт создан на платформе Nethouse. Хотите такой же?
Зарегистрировать домен .RU/.РФ за 140 рублей

2D  и 3D структуры белков с точностью до пикометра 

Принципиально новая возможность моделирования пространственной структуры белков и схем их вторичной структуры

для ещё экспериментально не изученных протеинов
 *


tttttt


 



Получите точную 2D и 3D структуру интересующего Вас белка через неделю

Только 3% белков поддаются кристаллизации, т.е. могут быть исследованы методом РСА (рентгено-структурного анализ).

Метод РСА трудоёмок, затратен по времени и стоимости и не даёт точного, детального и масштабируемого

пространственного изображения белковых молекул, см. белок KR2.  


2D и 3D структура белка закодирована в нуклеотидной последовательности.

Метод Пикотехнологии основан на открытии А.Ю.Кушелевым композиционного генетического кода,

а также на кольцегранной парадигме  для моделирования атомов и молекул.  

Отладка новейшей версии Пикотехнологии Белков Онлайн предусматривает уточнение композиционных углов.


Пикотехнолоия белков - незаменимый инструмент исследований для любых направленияй микробиологии и смежных дисциплин.

 Оценка доходности Пикософта


  Ваша заявка должна содержать лишь код интересующего Вас белка из базы данных PDB, либо мРНК для него
Мы смоделируем комплекс Вашего белка с лигандами любой природы
Сроки выполнения заказа 1-7 суток в зависимости от сложности проекта



Инвестиции в Пикософт

Подписаться на RSS

Вложения и доход от продаж точных 2D и 3D структур белков по методу Пикософт


Оценка доходности Пикософта


Купить книгу "Пикотехнология белков"




Подпишите петицию о государственной поддержке Лаборатории Наномир



Формы, механизмы, энергия наномира. Сообщение 86 982

Пикотехнология белков, ДНК, РНК - 2

Татьяна Рясина пишет:

есть ли некие результаты, который можно увидеть с помощью Пикотеха по  научной проблематике, которые исследователи сами увидеть не могут в силу ограниченности всей системы их методов? 

Кушелев: Во-первых, можно показать им правильную вторичную структуру белков. Это поможет им сделать серию научных открытий. Во-вторых, можно дать послушать им музыку сборки белков. Это тоже может привести к серии научных открытий. Ведь на слух можно быстро определить расположение активных центров белковых молекул...


Татьяна Рясина пишет:

по чём будут идти 3D структуры  с сайта?

Кушелев:

Надо сделать дешевле, чем по старой технологии (10 000 евро), точнее, быстрее, и в более полном объёме,

т.е. не 3% структур, как даёт РСА, а 100% всех белков.





Пикософт-Онлайн для ознакомления пользователей с возможностями Пикотехнологии


Отладка и создание онлайн версии Пикотехнолоии требует 2-х недель работы программиста и вложений в размере 200 000 рублей. Пикософт-Онлайн - способ практически без рекламных вложений и без риска для долевых участников завоевать интерес научной аудитории к новому методу исследования в микробиологии.

Прогноз доходности. Если мы берём долевое участие в запуске Пикософт-Онлайн в размере 2 000 рублей, то нужно собрать 100 человек для старта проекта.  Прогноз валового дохода Пикософт-Онлайн за год исходит из продаж структур в объёме 10 структур в месяц по цене 1 000 у.е. за структуру. Это составляет 120 000  у.е. в год.  Данная сумма сопоставима со стартовой стоимостью лицензирования Пикотехнологии в NCBI .   Если реинветсировать таким образом доход за первых год от Пикософт-Онлайн, со следующео года работы ресурса на каждого из участников приходится доля в валовом доходе за год в размере 1 200 у.е.  Онлайн сервис по быстрому точному определению структур белков, вместе с консультированием Лаборатории Наномир по вопросам, как применять данный инструмент исследования для производства открытий, служит для формирования репутации Пикотехнологии в научных кругах. А также формирует базу заитересованных пользователей для следующего этапа развития Пикотеха - международного продвижения метода. Предполагается, что продвижением Пикософта буду заниматься лица, имеющие долю в создании Пикософ-Онлайн.


Лицензирование Пикотехнологии в NCBI


Друзья, для продажи услуг по точному определению 2D и 3D структур белков необходима лицензия NCBI стоимостью от 100 000 USD. Мы объединяемся для совместного приобретения этой лицензии. Оставьте пожалуйста через форму "Напишите нам" или в разделе "Заявка инвестора"  краткое письмо о своём намерении оплатить долю в лицензировании NCBI, сумму, которую вы хотели бы внести и Ваши контакты для связи. 


Для того, чтобы внедрить пикотехнологию и зарабатывать до миллиона Евро в день,  нужно проплатить экспертизу NCBI, "международного минздрава", что может стоить от 100 000 до миллиона евро.


Также потребуется отладка существующей версии Пикософта , которая сегодня надёжно строит 2D структуры белков, и которую по известным алгоритмам необходимо довести до надёжного построения 3D структур белков  




Зато потом можно будет ежедневно выполнять заказы на миллион евро и даже больше.  Организовать это могут опытные менеджеры. 



http://nanoworld88.narod.ru/data/268_files/0_b0702_4d48f4b5_orig.gif


Image


user posted image



Заказы на структуры белков РСА. Ограничения метода РСА (рентгено-структурного анализа)


Формы, механизмы, энергия наномира. Сообщение 86 878

Пикотехнология белков, ДНК, РНК - 2

Татьяна Рясина пишет:

Как кратко пояснить, зачем нужен сайт с готовыми моделями? 

Люди вообще слышат и видят в первый раз в жизни.

Кушелев:

Ежедневно на нашей планете кто-то оплачивает не менее 30 заказов по структурам белковых молекул. Это видно по увеличению количества белков в Protein Data Base (PDB). За каждую структуру платят в среднем 10 000 евро и ждут от нескольких недель до нескольких лет.

Структуры нужны фармацевтам, биотехнологам, генным инженерам. Потенциальных заказчиков можно найти по ключевым словам protein, nanotech



РСА (ЧЕРЕЗ ПОИСК ФОРУМА ЛАБОРАТОРИИ НАНОМИР)

http://nanoworld.org.ru/search/1376839994/ 

Рентгенограммы РСА 

Результаты анализа рентгенограмм РСА 

97% белков не кристаллизуеся. Системные ошибки РСА 

РСА может показать чего нет и не показать что есть  

РСА цены   ,   , 

Точность РСА   ,   ,   ,     ,  

Корреляция данных РСА с Пикотех  

РСА стремится к Пикотех 

Лауэграммы и ренгенограммы  ,  

Молекула лизоцима 




http://www.vokrugsveta.ru/telegraph/theory/1071/

https://img-fotki.yandex.ru/get/194492/158289418.3a7/0_16df1f_9732efdb_XL.jpg
Цитата: Фотоотчет о выращивании белковых кристаллов на МКС во время 12-й экспедиции с 1 октября 2005 по 8 апреля 2006 года. Рост одного кристалла занимал 25 дней. Фото: NASA


Skype, 2016-12-21:

[20:05:27] Кушелев Александр Юрьевич: 500 000 / 120 = 4167 USD за один кристалл белка. Добавьте сюда сопутствующие работы, например, собственно РСА и анализ данных.
[21:04:47] Кушелев Александр Юрьевич: Вам эти фразы должны понравиться:

https://img-fotki.yandex.ru/get/61266/158289418.3a7/0_16df20_8cf98a5a_XL.jpg
"из невразумительных точек и кругов с помощью специальных математических преобразований получают информацию о расположении атомов. Для неспециалистов выглядят как шарлатанство. Даже если решетка несложной формы, эта задача непростая, но все честно." Подробнее: http://www.vokrugsveta.ru/telegraph/theory/1071/
[21:09:54] Кушелев Александр Юрьевич: При большом везении при переборе 600 условий кристаллизации найдется 1–2 раствора, в которых появятся кристаллы. Как правило, на первом этапе они небольшие, непрозрачные и совершенно неправильной формы, то есть не подходящие для рентгеноструктурного анализа.
[21:15:41] Кушелев Александр Юрьевич: Вот ещё цитата о цене белкового кристалла:  На получение одного кристалла белка ученые могут потратить десятки тысяч евро, а фармацевтические компании готовы заплатить еще большие деньги за подробную информацию о структуре какого-нибудь важного для медицины белка — «замка», к которому можно подбирать «отмычку» — лекарство.


Skype, 2016-12-21:

[19:54:52] Кушелев Александр Юрьевич: Например, узнайте цену структуры белка, кристалл которого нужно выращивать 2 года smile
[19:55:12] Andrei: речь не обо мне а о вас, знаете ли вы цену или просто придумываете smile
[19:59:00] Кушелев Александр Юрьевич: Мне сказали цену специалисты из лаборатории РСА
[19:59:15] Кушелев Александр Юрьевич: Кстати, почитайте ещё раз, как проводится анализ: http://bio.1september.ru/view_article.php?ID=200900401
[20:00:25] Andrei: Сказать это одно, а заказать другое:)
[20:01:35] Кушелев Александр Юрьевич: Вот сюда позвоните и спросите, сколько будет стоить кристаллизация белка (минимум и максимум): http://www.piboc.dvo.ru/structure/ext_l … ristal.php
[20:03:14] Andrei: Ладно, это мелочь
[20:03:31] Andrei: Надо искать кому это нужно и зачем
[20:03:46] Кушелев Александр Юрьевич: Вот Вам конкретные данные:  "со ста двадцатью образцами работа еще даже не начиналась. На их восстановление потребуется не меньше полумиллиона долларов и от нескольких недель до нескольких месяцев работы." Подробнее: http://www.vokrugsveta.ru/telegraph/theory/1071/
[20:04:08] Кушелев Александр Юрьевич: 120 кристаллов белка - 500 000 долл.
[20:05:27] Кушелев Александр Юрьевич: 500 000 / 120 = 4167 USD за один кристалл белка. Добавьте сюда сопутствующие работы, например, собственно РСА и анализ данных.


Белок KR2. Оптогенетика. Лаборатория перспективных исследований мембранных белков МФТИ. Структура KR2 по Пикотехнологии Кушелева. Для авторов: Георг Бюлдт (Georg Bueldt) , Валентин Горделий, Валентин Борщевский, Вадим Черезов.

Татьяна Рясина пишет:

Вы могли бы сделать 2D,3D, 4D структуру белка KR2 на обновлённой версии Пикотеха?

Кушелев: Так новая версия ещё не готова. Программист сильно занят. Пока нашёл время только на усовершенствование 2D-версии. Но даже на этом уровне хорошо видно, что РСА не "видит" даже вторичную структуру белка. Поэтому исследователи заполняют её кусками альфа-спиралей "от фонаря" smile

А реальная структура совсем другая.

http://nanoworld.org.ru/post/81583/#p81583
Я конечно, могу запустить определение третичной структуры на старой версии Пикотех, но может быть много ошибок. Запускать?



Татьяна Рясина пишет:

А самые новые апрельские структуры Вы в старой версии делаете?
Чисто житейски лучше конечно подождать версию без ошибок.
А потом выслать профессуре МФТИ.

Куешелев:

Да, пока в старой. Для спиральных участков это обычно "прокатывает", но тоже не всегда. Программные спирали бывают разные...



Татьяна Рясина пишет:

Но конечно хочется в старой версии увидеть тоже ))))

Кушелев: Сейчас попробую сделать



Под данным РСА - сплошные альфа-спирали, а программа Пикотех показывает пи-спирали и программные спирали. Во всей структуре попался только один виток альфа-спирали и 4 одиночных витка 310-спирали smile



Детали проекта

Подписаться на RSS

Проект он-лайн сервиса "Структура белка по нуклеотидной последовательности"

Заявка инвестора

Оценка доходности Пикософта       Пикотехнология белков

Структура белка KR2. Альфа спиралей нет

Расширенная программируемая архитектура белков

Музыка молекул

Уточнение композиционных углов, апрель 2017

Новые структуры белков, март-апрель 2017  

Ключи от генома найдены

https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.pnghttps://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png




Разработка сервиса Пикософт-Онлайн требует 2 недели работы программиста Лаборатории Наномир,

затраты составляют оценочно 200 000 рублей. Работающий сервис Пикософт-онлайн

позволит в течение одного года получить валовый доход,

сопоставимый со стартовой стоимостью лицензирования NCBI.


Валовый доход  за первый год работы сайта Пикософт-онлайн  

реинвестируется в лицензирование Пикотехнологии в NCBI.

По пронозным оценкам валовый доход  сервиса ежегодно составит от 12 000 у.е. в год.  


Сервис Пикософт-онлайн является отправным пунктом для последующего международного продвижения  

Пикотехнологии .  Если Вас  заинтересовала коммерческая перспектива сервиса

Пикософт-онлайн  - как сама по себе так и в качестве отправного пункта для последующего

международного развития Пикотехнологии белков  -  направьте пожалуйста Вашу краткую заявку со

страницы "Заявка инвестора" или на почту нашего сайта через форму "Написать письмо"

В заявке укажите, какую долю от стомости разработки сервиса Пикософт-Онлайн вы хотели бы вложить.

Список заинтересованных участников будет пополняться по мере поступления заявок. 



Татьяна Рясина пишет:

по чём будут идти 3D структуры  с сайта?

Кушелев:

Надо сделать дешевле, чем по старой технологии (10 000 евро), точнее, быстрее, и в более полном объёме,

т.е. не 3% структур, как даёт РСА, а 100% всех белков.


Формы, механизмы, энергия наномира. Сообщение 86 504

Пикотехнология белков, ДНК, РНК - 2

Skype:

[22.03.2017 18:49:44] Кушелев Александр Юрьевич: А список меню постепенно растёт...
1. 2D-структура в новом формате.
2. Файл в стандарте MIDI
3. Компактный файл fasta (с отработанными Join и Complement)
4. Компактный файл dne/embl (только идентификатор белка и входной код. С простым CDS 1..n)
5. 2D-структура в старом формате (как сейчас) с разбивкой по 1000 строк. 
6. Композиционный код-6
7. Композиционный код-4


Дополнительно

8. Компактная запись вторичной структуры с раскрашиванием триплетов


 Раскрашивание триплетов по алгоритму вторичной структуры экономит время.

 Раскрашивание триплетов входной последовательности позволяет сразу копировать код интересной структуры для дальнейшей обработки.

https://img-fotki.yandex.ru/get/59572/158289418.3f2/0_1778fa_4e7c4fee_XL.png




Формы, механизмы, энергия наномира. Сообщение 87 155

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/10 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/1049454220

>ENA|SBT74786|complement 17955 nucleotides


Программная 233555-спираль с одиннадцатиричной симметрией.

https://img-fotki.yandex.ru/get/61266/158289418.3fd/0_178407_5a757441_orig.png

https://img-fotki.yandex.ru/get/96333/158289418.3fd/0_17840b_282f376_orig.png

https://img-fotki.yandex.ru/get/50526/158289418.3fd/0_17840c_c2a78bfe_orig.png

Удлиним...

https://img-fotki.yandex.ru/get/104595/158289418.3fd/0_17840e_ba3cc9bf_orig.png

Развернуто: https://img-fotki.yandex.ru/get/233608/ … e_orig.png

https://img-fotki.yandex.ru/get/196183/158289418.3fd/0_17840f_1e017a27_orig.png

https://img-fotki.yandex.ru/get/195132/158289418.3fd/0_178410_59abd5fc_orig.png

https://img-fotki.yandex.ru/get/61411/158289418.3fd/0_178411_f559d9f_orig.png

https://img-fotki.yandex.ru/get/95629/158289418.3fd/0_178412_b1dcf024_orig.png

https://img-fotki.yandex.ru/get/105020/158289418.3fd/0_178413_c4ddf21e_orig.png

https://img-fotki.yandex.ru/get/44951/158289418.3fd/0_178414_fb478e4d_orig.png

https://img-fotki.yandex.ru/get/93917/158289418.3fd/0_178415_cef55c47_orig.png

https://img-fotki.yandex.ru/get/57551/158289418.3fd/0_178416_b1177b20_orig.png

https://img-fotki.yandex.ru/get/61164/158289418.3fd/0_178417_600ef975_orig.png

https://img-fotki.yandex.ru/get/233044/158289418.3fd/0_178418_58b31736_orig.png

https://img-fotki.yandex.ru/get/48069/158289418.3fd/0_178419_165cb31d_orig.gif


Формы, механизмы, энергия наномира. Сообщение 87 018

Пикотехнология белков, ДНК, РНК - 2

Фрактальные спирали белков

https://img-fotki.yandex.ru/get/114207/158289418.3f3/0_177ad3_dc903c85_orig.png

https://img-fotki.yandex.ru/get/198976/158289418.3f3/0_177ad4_beec6a28_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3f3/0_177ad5_68076c18_orig.png

Удлиним участок спирали, чтобы посмотреть, как будет выглядеть несколько витков

https://img-fotki.yandex.ru/get/106972/158289418.3f3/0_177ad6_7fdd5a7f_orig.png

Это - фрактальная спираль, т.е. спираль из спирали. Аналогичную структуру имеют кварки:


https://img-fotki.yandex.ru/get/105980/158289418.2ae/0_15008c_df8789f2_L.jpg
Подробнее: http://nanoworld.org.ru/topic/1365/

https://img-fotki.yandex.ru/get/114207/158289418.3f3/0_177ad7_d37e6f29_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3f3/0_177ad8_701f50ae_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.3f3/0_177ad9_631ff225_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3f3/0_177adb_773b5f39_orig.png


Формы, механизмы, энергия наномира. Сообщение 86 942

Пикотехнология белков, ДНК, РНК - 2

Ключи от генома найдены!

Кушелев: Ключи от генома работают!

Ищем: VGWLVGWLVGWLVGWLVGWLVGWLVGWLVGWL

https://www.ncbi.nlm.nih.gov/protein/11 … F163M9Y013

https://www.ncbi.nlm.nih.gov/nuccore/1129202806

>ENA|OLQ05543|259 nucleotides (fragment)
ttattggttggttggttggttggtcggtcggttggttggctgattggctggttggctggt
tggtgggttggtgggttggtgggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
ttggttggttggttggttg


https://img-fotki.yandex.ru/get/104595/158289418.3f2/0_1778fe_80e0fa74_orig.png

https://img-fotki.yandex.ru/get/242441/158289418.3f2/0_1778fc_f2050cd_orig.png

https://img-fotki.yandex.ru/get/169883/158289418.3f2/0_1778fd_685b1548_orig.gif

https://img-fotki.yandex.ru/get/228104/158289418.3f2/0_177906_df4150ff_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.3f2/0_177905_ce103f86_orig.png

https://img-fotki.yandex.ru/get/195694/158289418.3f2/0_1778ff_81599ecf_orig.png

https://img-fotki.yandex.ru/get/9092/158289418.3f2/0_177900_eca5f3ef_orig.png

https://img-fotki.yandex.ru/get/249078/158289418.3f2/0_177902_efd7a6b1_orig.png

https://img-fotki.yandex.ru/get/59572/158289418.3f2/0_177903_8a8730c3_orig.png

https://img-fotki.yandex.ru/get/198786/158289418.3f2/0_177904_fc452cad_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 160

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/80 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/808137793


>ENA|XP_012171147|4407 nucleotides

https://img-fotki.yandex.ru/get/202385/158289418.3fe/0_1784d8_d9378837_orig.png

https://img-fotki.yandex.ru/get/402270/158289418.3fe/0_1784d9_2ef79dd8_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3fe/0_1784df_5e726197_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.3fe/0_1784e0_76fdd78d_orig.png

https://img-fotki.yandex.ru/get/117578/158289418.3fe/0_1784e1_b97fc7ee_orig.png

https://img-fotki.yandex.ru/get/198361/158289418.3fe/0_1784e2_73317869_orig.png

https://img-fotki.yandex.ru/get/195195/158289418.3fe/0_1784e3_2c83eb9_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.3fe/0_1784e4_7fcd7129_orig.png

https://img-fotki.yandex.ru/get/177849/158289418.3fe/0_1784e5_76d64d09_orig.png

https://img-fotki.yandex.ru/get/249078/158289418.3fe/0_1784e6_e409bdb8_orig.png
Программная 5352-спираль с десятиричной симметрией.



Формы, механизмы, энергия наномира. Сообщение 87 162

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966919

>ENA|XP_016159448|1578 nucleotides

https://img-fotki.yandex.ru/get/217607/158289418.3ff/0_1784e8_c5199f60_orig.png

Прямая альфа-спираль длиной 500(!) одинаковых аминокислотных остатков Pro.

https://img-fotki.yandex.ru/get/196365/158289418.3ff/0_1784e9_d77a01c0_orig.png

https://img-fotki.yandex.ru/get/246155/158289418.3ff/0_1784ea_9bf11421_orig.png

https://img-fotki.yandex.ru/get/168237/158289418.3ff/0_1784eb_b00932a_orig.png

https://img-fotki.yandex.ru/get/205820/158289418.3ff/0_1784ec_ed1f980a_orig.png

https://img-fotki.yandex.ru/get/218038/158289418.3ff/0_1784ed_a58066c7_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.3ff/0_1784ee_341cf04e_orig.png

https://img-fotki.yandex.ru/get/172017/158289418.3ff/0_1784ef_d6261ed9_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.3ff/0_1784f0_128d0270_orig.png

https://img-fotki.yandex.ru/get/119695/158289418.3ff/0_1784f1_45aef56_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.3ff/0_1784f2_68861514_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 163

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966125

>ENA|XP_016159174|1533 nucleotides

https://img-fotki.yandex.ru/get/196020/158289418.3ff/0_1784f4_88157e8e_orig.png

В этом белке прямой альфа-спиральный участок на полсотни аминокислотных остатков короче.

https://img-fotki.yandex.ru/get/226827/158289418.3ff/0_1784f5_30f7ad19_orig.png

https://img-fotki.yandex.ru/get/197756/158289418.3ff/0_1784f6_3e9728a1_orig.png

https://img-fotki.yandex.ru/get/228174/158289418.3ff/0_1784f7_82a02531_orig.png

Интересно, зачем нужен этот излом прямой альфа-спирали?



Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 87 152

QNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNE

https://blast.ncbi.nlm.nih.gov

https://www.ncbi.nlm.nih.gov/protein/64 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/641581791

>ENA|CDO63981|complement 2670 nucleotides

https://img-fotki.yandex.ru/get/58321/158289418.3fc/0_1783e9_bdab1c30_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.3fc/0_1783ea_51716008_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 156

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/10 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/1037140091

>ENA|SBS85453|4629 nucleotides


https://img-fotki.yandex.ru/get/196141/158289418.3fd/0_178427_936fd7c4_orig.png

https://img-fotki.yandex.ru/get/170815/158289418.3fd/0_178428_ad8c02ec_orig.png

Рассмотрим фрагмент:

https://img-fotki.yandex.ru/get/196258/158289418.3fd/0_17842c_a12fbeca_orig.png

https://img-fotki.yandex.ru/get/54787/158289418.3fd/0_17842a_c871eee5_orig.png

https://img-fotki.yandex.ru/get/166616/158289418.3fd/0_17842d_fcc2c450_orig.png

https://img-fotki.yandex.ru/get/56796/158289418.3fd/0_17842e_728eac9a_orig.png

https://img-fotki.yandex.ru/get/170815/158289418.3fd/0_17842f_b6bf20b0_orig.png

https://img-fotki.yandex.ru/get/235925/158289418.3fd/0_178430_be37c608_orig.png

Обратите внимание, как точно замыкается цикл Asp432...Met441




Формы, механизмы, энергия наномира. Сообщение 87 159

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/31 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/310757913

>ENA|ADP16330|complement 3063 nucleotides

https://img-fotki.yandex.ru/get/59572/158289418.3fe/0_1784bd_44c44adc_orig.png

вернуто: https://img-fotki.yandex.ru/get/55431/1 … 3_orig.png

https://img-fotki.yandex.ru/get/61897/158289418.3fe/0_1784be_d77c0c98_orig.png

https://img-fotki.yandex.ru/get/198613/158289418.3fe/0_1784bf_f666ea84_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3fe/0_1784c0_f2ca9981_orig.png
Антипараллельные альфа-спиральные участки. Именно так изображают сегодня практически все белковые молекулы в Protein Data Base, но в действительности так выглядит только один тип белковых молекул, а специалисты по РСА пытаются заполнять альфа-спиралями большинство моделей белков, что является систематической ошибкой.

Фрагмент:

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784c8_f7e89082_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.3fe/0_1784c7_727231f3_orig.png

https://img-fotki.yandex.ru/get/197756/158289418.3fe/0_1784c9_63cc7cfc_orig.png
Снова мы видим антигомологичный участок. Из одинаковых аминокислотных остатков собрана сложная конструкция с чередованием разных композиционных кодов.

https://img-fotki.yandex.ru/get/196365/158289418.3fe/0_1784ca_5fed2212_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cb_89487972_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cc_81e4ce83_orig.png

https://img-fotki.yandex.ru/get/228104/158289418.3fe/0_1784cd_4527965_orig.png

https://img-fotki.yandex.ru/get/233740/158289418.3fe/0_1784ce_5d47d401_orig.pnghttps://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cf_3e8ad4f7_orig.png


https://img-fotki.yandex.ru/get/228104/158289418.3fe/0_1784d1_33c1e226_orig.png

Браузер показывает спираль переменного радиуса (коническую). Вероятно, он вычисляет радиус спирали с учётом радикалов аминокислотных остатков.

Рассмотрим этот фрагмент подробнее...

https://img-fotki.yandex.ru/get/196183/158289418.3fe/0_1784d3_3ee6017b_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3fe/0_1784d2_a40c7857_orig.png

https://img-fotki.yandex.ru/get/171919/158289418.3fe/0_1784d4_8e6fac98_orig.png

https://img-fotki.yandex.ru/get/216915/158289418.3fe/0_1784d5_a6844adc_orig.png

Любопытно, что радиус пептидных групп увеличивается, т.к. 310-спираль перешла в альфа-спираль, но, вероятно, из-за радикалов браузер показывает уменьшение радиуса спирали в конце фрагмента.



https://www.ncbi.nlm.nih.gov/protein/11 … PG4YMDD013

https://www.ncbi.nlm.nih.gov/nuccore/1147196514

>ENA|XP_020045571|5904 nucleotides

https://img-fotki.yandex.ru/get/93500/158289418.3f4/0_177be9_7bb8f8d8_orig.png

https://img-fotki.yandex.ru/get/177849/158289418.3f4/0_177bea_9476f9c3_orig.png

https://img-fotki.yandex.ru/get/166616/158289418.3f4/0_177bec_79f9ef48_orig.png

https://img-fotki.yandex.ru/get/243369/158289418.3f4/0_177bee_da5dcc38_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3f4/0_177bef_82eddebf_orig.png

https://img-fotki.yandex.ru/get/243369/158289418.3f4/0_177bf0_343ddac8_orig.png

Кушелев: Пикотехнология помогла восстановить экспериментальные данные!



Формы, механизмы, энергия наномира. Сообщение 87 165

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966127

>ENA|XP_016159175|1557 nucleotides

https://img-fotki.yandex.ru/get/239438/158289418.3ff/0_17850d_83748b8_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.3ff/0_17850c_e189ae92_orig.png

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_17850e_6274db3f_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3ff/0_17850f_580f998f_orig.png



Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/11 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1158926006

>ENA|XP_020310926|1548 nucleotides

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_178511_ee8d4131_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3ff/0_178512_ae7f229c_orig.png

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_178513_104091a2_orig.png

Кушелев: Обратите внимание на параллельность крайних участков ломаной пролиновой спирали.



https://www.ncbi.nlm.nih.gov/protein/82 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/820852004

>ENA|XP_012343509|4566 nucleotides

https://img-fotki.yandex.ru/get/195125/158289418.3ff/0_178516_2b514a2b_orig.png

https://img-fotki.yandex.ru/get/194835/158289418.3ff/0_178517_21f79f38_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3ff/0_178518_e847ae6b_orig.png

https://img-fotki.yandex.ru/get/30536/158289418.3ff/0_178519_8fd4ee06_orig.png



https://www.ncbi.nlm.nih.gov/protein/80 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/808137791

>ENA|XP_012171146|4629 nucleotides


https://img-fotki.yandex.ru/get/114758/158289418.3ff/0_178521_aa51abf_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3ff/0_178522_42ced0c_orig.png

https://img-fotki.yandex.ru/get/225029/158289418.3ff/0_178523_ed3c84_orig.png

https://img-fotki.yandex.ru/get/171750/158289418.3ff/0_178524_2dd51b0b_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3ff/0_178525_cbb1237f_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/197213/158289418.3ff/0_178527_7ee1f54a_orig.png

https://img-fotki.yandex.ru/get/249307/158289418.3ff/0_178526_ae4e7b61_orig.png

https://img-fotki.yandex.ru/get/51134/158289418.3ff/0_178528_1274083f_orig.png

https://img-fotki.yandex.ru/get/43388/158289418.400/0_178529_e3791ad3_orig.png



https://www.ncbi.nlm.nih.gov/protein/57 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1032010406

>ENA|XP_006565803|4308 nucleotides

https://img-fotki.yandex.ru/get/194858/158289418.400/0_17852c_f11f80f6_orig.png

https://img-fotki.yandex.ru/get/217607/158289418.400/0_17852d_621cb584_orig.png

https://img-fotki.yandex.ru/get/229651/158289418.400/0_17852e_3c4d4c63_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/217607/158289418.400/0_178530_4cfd8b8c_orig.png

https://img-fotki.yandex.ru/get/217607/158289418.400/0_17852f_d7450853_orig.png

https://img-fotki.yandex.ru/get/108697/158289418.400/0_178531_42a59768_orig.png

https://img-fotki.yandex.ru/get/57985/158289418.400/0_178532_b93c1dd6_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.400/0_178533_9ca517f8_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.400/0_178534_1b1f6666_orig.png




https://www.ncbi.nlm.nih.gov/protein/30 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/302829403

>ENA|XP_002946269|7917 nucleotides


https://img-fotki.yandex.ru/get/235015/158289418.400/0_17853a_1a960b56_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/228174/158289418.400/0_17853c_d5016e3d_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.400/0_17853d_1d99ca46_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.400/0_17853b_7fb57c50_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.400/0_17853e_dd41dbfd_orig.png

https://img-fotki.yandex.ru/get/194492/158289418.400/0_178540_74bfd6b3_orig.png

https://img-fotki.yandex.ru/get/237001/158289418.400/0_17853f_7683a810_orig.png
Программная 23-спираль с одиннадцатиричной симметрией аксиальной проекции. Как видим полипролин может встречаться как в виде прямой или ломаной альфа-спирали, так и в виде программной 23-спирали, и вообще как программная произвольная форма.



Пикотехнология белков, ДНК, РНК - 3

Ищем 48 символов D подряд

https://blast.ncbi.nlm.nih.gov

Нашёлся единственный(!) белок:

https://www.ncbi.nlm.nih.gov/protein/10 … CT76DGC016

https://www.ncbi.nlm.nih.gov/nuccore/1039188425

>ENA|OBQ31849|complement 529 nucleotides
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgacgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatg


https://img-fotki.yandex.ru/get/177902/158289418.400/0_178542_5f21e856_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.400/0_178546_88b12942_orig.png

https://img-fotki.yandex.ru/get/114207/158289418.400/0_178543_40892484_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.400/0_178544_d8b4b87c_orig.png

https://img-fotki.yandex.ru/get/177902/158289418.400/0_178545_e55239b_orig.png

https://img-fotki.yandex.ru/get/194835/158289418.400/0_178547_7f261108_orig.png

Кушелев: Интересно, зачем нужен такой экзотический белок? Сверхдлинная пи-спираль с одним изломом.





Читать дальше

Лицензирование Пикотехнологии в NCBI


Уважаемые друзья!


Если Вас заинтересовала коммерческая перспектива проекта Пикософт, отправьте нам  краткое уведомление о Вашей заинтересованности с указанием удобных для Вас контактов для связи. 


Мы предлагаем совместно долевым образом профинансировать лицензирование Пикософта в NCBI . Предполагается долевое участие на одного участника в объёме 100 USD или 6000 рублей  (ориентируясь на курс начала апреля 2017)


Вы можете ознакомиться со списком лиц , проявивших интерес к проекту и отправить Вашу заявку  по ссылке или воспользоваться формой обратной связи для писем в самом верху.


Список лиц, проявивших интерес в Пикософту, будет пополняться по мере поступления заявок. 


С пожеланиями счастья,

Ваша

Лаборатория Наномир










Читать дальше

Проявили интерес

Лаборатория Наномир


Более 500 открытий за 25 лет


Телефоны

+7 (903) 2003424

+7 (916) 8265031

+7 (926) 5101703


Сайты

https://nano-world-articles.nethouse.ru/ (Дайджест Лаборатории Наномир)

nanoworld.narod.ru/  (Лаборатория Наномир)

http://nanoworld.org.ru/data/  (ЭНЦИКЛОПЕДИЯ НАНОМИР)

nanoworld.org.ru  (Форум Лаборатории Наномир)

subscribe.ru/catalog/science.news.nanoworldnews  (Новости Лаборатории Наномир)

https://nanomir.info/  (Новые направления Лаборатории Наномир)


E-mail

kushelev20120@yandex.ru


Skype

kushelev2009 (Кушелев А.Ю.)