Домены .ru и .рф за 140 рублей в год. От аккредитованного регистратора.

2D  и 3D структуры белков с точностью до пикометра 

Принципиально новая возможность моделирования пространственной структуры белков и схем их вторичной структуры

для ещё экспериментально не изученных протеинов
 *


tttttt


 



Проект он-лайн сервиса "Структура белка по нуклеотидной последовательности"

Заявка инвестора

Оценка доходности Пикософта       Пикотехнология белков

Структура белка KR2. Альфа спиралей нет

Расширенная программируемая архитектура белков

Музыка молекул

Уточнение композиционных углов, апрель 2017

Новые структуры белков, март-апрель 2017  

Ключи от генома найдены

https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.pnghttps://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png




Разработка сервиса Пикософт-Онлайн требует 2 недели работы программиста Лаборатории Наномир,

затраты составляют оценочно 200 000 рублей. Работающий сервис Пикософт-онлайн

позволит в течение одного года получить валовый доход,

сопоставимый со стартовой стоимостью лицензирования NCBI.


Валовый доход  за первый год работы сайта Пикософт-онлайн  

реинвестируется в лицензирование Пикотехнологии в NCBI.

По пронозным оценкам валовый доход  сервиса ежегодно составит от 12 000 у.е. в год.  


Сервис Пикософт-онлайн является отправным пунктом для последующего международного продвижения  

Пикотехнологии .  Если Вас  заинтересовала коммерческая перспектива сервиса

Пикософт-онлайн  - как сама по себе так и в качестве отправного пункта для последующего

международного развития Пикотехнологии белков  -  направьте пожалуйста Вашу краткую заявку со

страницы "Заявка инвестора" или на почту нашего сайта через форму "Написать письмо"

В заявке укажите, какую долю от стомости разработки сервиса Пикософт-Онлайн вы хотели бы вложить.

Список заинтересованных участников будет пополняться по мере поступления заявок. 



Татьяна Рясина пишет:

по чём будут идти 3D структуры  с сайта?

Кушелев:

Надо сделать дешевле, чем по старой технологии (10 000 евро), точнее, быстрее, и в более полном объёме,

т.е. не 3% структур, как даёт РСА, а 100% всех белков.


Формы, механизмы, энергия наномира. Сообщение 86 504

Пикотехнология белков, ДНК, РНК - 2

Skype:

[22.03.2017 18:49:44] Кушелев Александр Юрьевич: А список меню постепенно растёт...
1. 2D-структура в новом формате.
2. Файл в стандарте MIDI
3. Компактный файл fasta (с отработанными Join и Complement)
4. Компактный файл dne/embl (только идентификатор белка и входной код. С простым CDS 1..n)
5. 2D-структура в старом формате (как сейчас) с разбивкой по 1000 строк. 
6. Композиционный код-6
7. Композиционный код-4


Дополнительно

8. Компактная запись вторичной структуры с раскрашиванием триплетов


 Раскрашивание триплетов по алгоритму вторичной структуры экономит время.

 Раскрашивание триплетов входной последовательности позволяет сразу копировать код интересной структуры для дальнейшей обработки.

https://img-fotki.yandex.ru/get/59572/158289418.3f2/0_1778fa_4e7c4fee_XL.png




Формы, механизмы, энергия наномира. Сообщение 87 155

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/10 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/1049454220

>ENA|SBT74786|complement 17955 nucleotides


Программная 233555-спираль с одиннадцатиричной симметрией.

https://img-fotki.yandex.ru/get/61266/158289418.3fd/0_178407_5a757441_orig.png

https://img-fotki.yandex.ru/get/96333/158289418.3fd/0_17840b_282f376_orig.png

https://img-fotki.yandex.ru/get/50526/158289418.3fd/0_17840c_c2a78bfe_orig.png

Удлиним...

https://img-fotki.yandex.ru/get/104595/158289418.3fd/0_17840e_ba3cc9bf_orig.png

Развернуто: https://img-fotki.yandex.ru/get/233608/ … e_orig.png

https://img-fotki.yandex.ru/get/196183/158289418.3fd/0_17840f_1e017a27_orig.png

https://img-fotki.yandex.ru/get/195132/158289418.3fd/0_178410_59abd5fc_orig.png

https://img-fotki.yandex.ru/get/61411/158289418.3fd/0_178411_f559d9f_orig.png

https://img-fotki.yandex.ru/get/95629/158289418.3fd/0_178412_b1dcf024_orig.png

https://img-fotki.yandex.ru/get/105020/158289418.3fd/0_178413_c4ddf21e_orig.png

https://img-fotki.yandex.ru/get/44951/158289418.3fd/0_178414_fb478e4d_orig.png

https://img-fotki.yandex.ru/get/93917/158289418.3fd/0_178415_cef55c47_orig.png

https://img-fotki.yandex.ru/get/57551/158289418.3fd/0_178416_b1177b20_orig.png

https://img-fotki.yandex.ru/get/61164/158289418.3fd/0_178417_600ef975_orig.png

https://img-fotki.yandex.ru/get/233044/158289418.3fd/0_178418_58b31736_orig.png

https://img-fotki.yandex.ru/get/48069/158289418.3fd/0_178419_165cb31d_orig.gif


Формы, механизмы, энергия наномира. Сообщение 87 018

Пикотехнология белков, ДНК, РНК - 2

Фрактальные спирали белков

https://img-fotki.yandex.ru/get/114207/158289418.3f3/0_177ad3_dc903c85_orig.png

https://img-fotki.yandex.ru/get/198976/158289418.3f3/0_177ad4_beec6a28_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3f3/0_177ad5_68076c18_orig.png

Удлиним участок спирали, чтобы посмотреть, как будет выглядеть несколько витков

https://img-fotki.yandex.ru/get/106972/158289418.3f3/0_177ad6_7fdd5a7f_orig.png

Это - фрактальная спираль, т.е. спираль из спирали. Аналогичную структуру имеют кварки:


https://img-fotki.yandex.ru/get/105980/158289418.2ae/0_15008c_df8789f2_L.jpg
Подробнее: http://nanoworld.org.ru/topic/1365/

https://img-fotki.yandex.ru/get/114207/158289418.3f3/0_177ad7_d37e6f29_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3f3/0_177ad8_701f50ae_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.3f3/0_177ad9_631ff225_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3f3/0_177adb_773b5f39_orig.png


Формы, механизмы, энергия наномира. Сообщение 86 942

Пикотехнология белков, ДНК, РНК - 2

Ключи от генома найдены!

Кушелев: Ключи от генома работают!

Ищем: VGWLVGWLVGWLVGWLVGWLVGWLVGWLVGWL

https://www.ncbi.nlm.nih.gov/protein/11 … F163M9Y013

https://www.ncbi.nlm.nih.gov/nuccore/1129202806

>ENA|OLQ05543|259 nucleotides (fragment)
ttattggttggttggttggttggtcggtcggttggttggctgattggctggttggctggt
tggtgggttggtgggttggtgggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
ttggttggttggttggttg


https://img-fotki.yandex.ru/get/104595/158289418.3f2/0_1778fe_80e0fa74_orig.png

https://img-fotki.yandex.ru/get/242441/158289418.3f2/0_1778fc_f2050cd_orig.png

https://img-fotki.yandex.ru/get/169883/158289418.3f2/0_1778fd_685b1548_orig.gif

https://img-fotki.yandex.ru/get/228104/158289418.3f2/0_177906_df4150ff_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.3f2/0_177905_ce103f86_orig.png

https://img-fotki.yandex.ru/get/195694/158289418.3f2/0_1778ff_81599ecf_orig.png

https://img-fotki.yandex.ru/get/9092/158289418.3f2/0_177900_eca5f3ef_orig.png

https://img-fotki.yandex.ru/get/249078/158289418.3f2/0_177902_efd7a6b1_orig.png

https://img-fotki.yandex.ru/get/59572/158289418.3f2/0_177903_8a8730c3_orig.png

https://img-fotki.yandex.ru/get/198786/158289418.3f2/0_177904_fc452cad_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 160

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/80 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/808137793


>ENA|XP_012171147|4407 nucleotides

https://img-fotki.yandex.ru/get/202385/158289418.3fe/0_1784d8_d9378837_orig.png

https://img-fotki.yandex.ru/get/402270/158289418.3fe/0_1784d9_2ef79dd8_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3fe/0_1784df_5e726197_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.3fe/0_1784e0_76fdd78d_orig.png

https://img-fotki.yandex.ru/get/117578/158289418.3fe/0_1784e1_b97fc7ee_orig.png

https://img-fotki.yandex.ru/get/198361/158289418.3fe/0_1784e2_73317869_orig.png

https://img-fotki.yandex.ru/get/195195/158289418.3fe/0_1784e3_2c83eb9_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.3fe/0_1784e4_7fcd7129_orig.png

https://img-fotki.yandex.ru/get/177849/158289418.3fe/0_1784e5_76d64d09_orig.png

https://img-fotki.yandex.ru/get/249078/158289418.3fe/0_1784e6_e409bdb8_orig.png
Программная 5352-спираль с десятиричной симметрией.



Формы, механизмы, энергия наномира. Сообщение 87 162

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966919

>ENA|XP_016159448|1578 nucleotides

https://img-fotki.yandex.ru/get/217607/158289418.3ff/0_1784e8_c5199f60_orig.png

Прямая альфа-спираль длиной 500(!) одинаковых аминокислотных остатков Pro.

https://img-fotki.yandex.ru/get/196365/158289418.3ff/0_1784e9_d77a01c0_orig.png

https://img-fotki.yandex.ru/get/246155/158289418.3ff/0_1784ea_9bf11421_orig.png

https://img-fotki.yandex.ru/get/168237/158289418.3ff/0_1784eb_b00932a_orig.png

https://img-fotki.yandex.ru/get/205820/158289418.3ff/0_1784ec_ed1f980a_orig.png

https://img-fotki.yandex.ru/get/218038/158289418.3ff/0_1784ed_a58066c7_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.3ff/0_1784ee_341cf04e_orig.png

https://img-fotki.yandex.ru/get/172017/158289418.3ff/0_1784ef_d6261ed9_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.3ff/0_1784f0_128d0270_orig.png

https://img-fotki.yandex.ru/get/119695/158289418.3ff/0_1784f1_45aef56_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.3ff/0_1784f2_68861514_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 163

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966125

>ENA|XP_016159174|1533 nucleotides

https://img-fotki.yandex.ru/get/196020/158289418.3ff/0_1784f4_88157e8e_orig.png

В этом белке прямой альфа-спиральный участок на полсотни аминокислотных остатков короче.

https://img-fotki.yandex.ru/get/226827/158289418.3ff/0_1784f5_30f7ad19_orig.png

https://img-fotki.yandex.ru/get/197756/158289418.3ff/0_1784f6_3e9728a1_orig.png

https://img-fotki.yandex.ru/get/228174/158289418.3ff/0_1784f7_82a02531_orig.png

Интересно, зачем нужен этот излом прямой альфа-спирали?



Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 87 152

QNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNEQNE

https://blast.ncbi.nlm.nih.gov

https://www.ncbi.nlm.nih.gov/protein/64 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/641581791

>ENA|CDO63981|complement 2670 nucleotides

https://img-fotki.yandex.ru/get/58321/158289418.3fc/0_1783e9_bdab1c30_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.3fc/0_1783ea_51716008_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 156

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/10 … 3PJ5H0S013

https://www.ncbi.nlm.nih.gov/nuccore/1037140091

>ENA|SBS85453|4629 nucleotides


https://img-fotki.yandex.ru/get/196141/158289418.3fd/0_178427_936fd7c4_orig.png

https://img-fotki.yandex.ru/get/170815/158289418.3fd/0_178428_ad8c02ec_orig.png

Рассмотрим фрагмент:

https://img-fotki.yandex.ru/get/196258/158289418.3fd/0_17842c_a12fbeca_orig.png

https://img-fotki.yandex.ru/get/54787/158289418.3fd/0_17842a_c871eee5_orig.png

https://img-fotki.yandex.ru/get/166616/158289418.3fd/0_17842d_fcc2c450_orig.png

https://img-fotki.yandex.ru/get/56796/158289418.3fd/0_17842e_728eac9a_orig.png

https://img-fotki.yandex.ru/get/170815/158289418.3fd/0_17842f_b6bf20b0_orig.png

https://img-fotki.yandex.ru/get/235925/158289418.3fd/0_178430_be37c608_orig.png

Обратите внимание, как точно замыкается цикл Asp432...Met441




Формы, механизмы, энергия наномира. Сообщение 87 159

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/31 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/310757913

>ENA|ADP16330|complement 3063 nucleotides

https://img-fotki.yandex.ru/get/59572/158289418.3fe/0_1784bd_44c44adc_orig.png

вернуто: https://img-fotki.yandex.ru/get/55431/1 … 3_orig.png

https://img-fotki.yandex.ru/get/61897/158289418.3fe/0_1784be_d77c0c98_orig.png

https://img-fotki.yandex.ru/get/198613/158289418.3fe/0_1784bf_f666ea84_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3fe/0_1784c0_f2ca9981_orig.png
Антипараллельные альфа-спиральные участки. Именно так изображают сегодня практически все белковые молекулы в Protein Data Base, но в действительности так выглядит только один тип белковых молекул, а специалисты по РСА пытаются заполнять альфа-спиралями большинство моделей белков, что является систематической ошибкой.

Фрагмент:

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784c8_f7e89082_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.3fe/0_1784c7_727231f3_orig.png

https://img-fotki.yandex.ru/get/197756/158289418.3fe/0_1784c9_63cc7cfc_orig.png
Снова мы видим антигомологичный участок. Из одинаковых аминокислотных остатков собрана сложная конструкция с чередованием разных композиционных кодов.

https://img-fotki.yandex.ru/get/196365/158289418.3fe/0_1784ca_5fed2212_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cb_89487972_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cc_81e4ce83_orig.png

https://img-fotki.yandex.ru/get/228104/158289418.3fe/0_1784cd_4527965_orig.png

https://img-fotki.yandex.ru/get/233740/158289418.3fe/0_1784ce_5d47d401_orig.pnghttps://img-fotki.yandex.ru/get/166206/158289418.3fe/0_1784cf_3e8ad4f7_orig.png


https://img-fotki.yandex.ru/get/228104/158289418.3fe/0_1784d1_33c1e226_orig.png

Браузер показывает спираль переменного радиуса (коническую). Вероятно, он вычисляет радиус спирали с учётом радикалов аминокислотных остатков.

Рассмотрим этот фрагмент подробнее...

https://img-fotki.yandex.ru/get/196183/158289418.3fe/0_1784d3_3ee6017b_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3fe/0_1784d2_a40c7857_orig.png

https://img-fotki.yandex.ru/get/171919/158289418.3fe/0_1784d4_8e6fac98_orig.png

https://img-fotki.yandex.ru/get/216915/158289418.3fe/0_1784d5_a6844adc_orig.png

Любопытно, что радиус пептидных групп увеличивается, т.к. 310-спираль перешла в альфа-спираль, но, вероятно, из-за радикалов браузер показывает уменьшение радиуса спирали в конце фрагмента.



https://www.ncbi.nlm.nih.gov/protein/11 … PG4YMDD013

https://www.ncbi.nlm.nih.gov/nuccore/1147196514

>ENA|XP_020045571|5904 nucleotides

https://img-fotki.yandex.ru/get/93500/158289418.3f4/0_177be9_7bb8f8d8_orig.png

https://img-fotki.yandex.ru/get/177849/158289418.3f4/0_177bea_9476f9c3_orig.png

https://img-fotki.yandex.ru/get/166616/158289418.3f4/0_177bec_79f9ef48_orig.png

https://img-fotki.yandex.ru/get/243369/158289418.3f4/0_177bee_da5dcc38_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3f4/0_177bef_82eddebf_orig.png

https://img-fotki.yandex.ru/get/243369/158289418.3f4/0_177bf0_343ddac8_orig.png

Кушелев: Пикотехнология помогла восстановить экспериментальные данные!



Формы, механизмы, энергия наномира. Сообщение 87 165

Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1020966127

>ENA|XP_016159175|1557 nucleotides

https://img-fotki.yandex.ru/get/239438/158289418.3ff/0_17850d_83748b8_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.3ff/0_17850c_e189ae92_orig.png

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_17850e_6274db3f_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.3ff/0_17850f_580f998f_orig.png



Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/11 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1158926006

>ENA|XP_020310926|1548 nucleotides

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_178511_ee8d4131_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.3ff/0_178512_ae7f229c_orig.png

https://img-fotki.yandex.ru/get/30752/158289418.3ff/0_178513_104091a2_orig.png

Кушелев: Обратите внимание на параллельность крайних участков ломаной пролиновой спирали.



https://www.ncbi.nlm.nih.gov/protein/82 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/820852004

>ENA|XP_012343509|4566 nucleotides

https://img-fotki.yandex.ru/get/195125/158289418.3ff/0_178516_2b514a2b_orig.png

https://img-fotki.yandex.ru/get/194835/158289418.3ff/0_178517_21f79f38_orig.png

https://img-fotki.yandex.ru/get/166206/158289418.3ff/0_178518_e847ae6b_orig.png

https://img-fotki.yandex.ru/get/30536/158289418.3ff/0_178519_8fd4ee06_orig.png



https://www.ncbi.nlm.nih.gov/protein/80 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/808137791

>ENA|XP_012171146|4629 nucleotides


https://img-fotki.yandex.ru/get/114758/158289418.3ff/0_178521_aa51abf_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3ff/0_178522_42ced0c_orig.png

https://img-fotki.yandex.ru/get/225029/158289418.3ff/0_178523_ed3c84_orig.png

https://img-fotki.yandex.ru/get/171750/158289418.3ff/0_178524_2dd51b0b_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3ff/0_178525_cbb1237f_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/197213/158289418.3ff/0_178527_7ee1f54a_orig.png

https://img-fotki.yandex.ru/get/249307/158289418.3ff/0_178526_ae4e7b61_orig.png

https://img-fotki.yandex.ru/get/51134/158289418.3ff/0_178528_1274083f_orig.png

https://img-fotki.yandex.ru/get/43388/158289418.400/0_178529_e3791ad3_orig.png



https://www.ncbi.nlm.nih.gov/protein/57 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/1032010406

>ENA|XP_006565803|4308 nucleotides

https://img-fotki.yandex.ru/get/194858/158289418.400/0_17852c_f11f80f6_orig.png

https://img-fotki.yandex.ru/get/217607/158289418.400/0_17852d_621cb584_orig.png

https://img-fotki.yandex.ru/get/229651/158289418.400/0_17852e_3c4d4c63_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/217607/158289418.400/0_178530_4cfd8b8c_orig.png

https://img-fotki.yandex.ru/get/217607/158289418.400/0_17852f_d7450853_orig.png

https://img-fotki.yandex.ru/get/108697/158289418.400/0_178531_42a59768_orig.png

https://img-fotki.yandex.ru/get/57985/158289418.400/0_178532_b93c1dd6_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.400/0_178533_9ca517f8_orig.png

https://img-fotki.yandex.ru/get/55231/158289418.400/0_178534_1b1f6666_orig.png




https://www.ncbi.nlm.nih.gov/protein/30 … 9SRURKB013

https://www.ncbi.nlm.nih.gov/nuccore/302829403

>ENA|XP_002946269|7917 nucleotides


https://img-fotki.yandex.ru/get/235015/158289418.400/0_17853a_1a960b56_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/228174/158289418.400/0_17853c_d5016e3d_orig.png

https://img-fotki.yandex.ru/get/59977/158289418.400/0_17853d_1d99ca46_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.400/0_17853b_7fb57c50_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.400/0_17853e_dd41dbfd_orig.png

https://img-fotki.yandex.ru/get/194492/158289418.400/0_178540_74bfd6b3_orig.png

https://img-fotki.yandex.ru/get/237001/158289418.400/0_17853f_7683a810_orig.png
Программная 23-спираль с одиннадцатиричной симметрией аксиальной проекции. Как видим полипролин может встречаться как в виде прямой или ломаной альфа-спирали, так и в виде программной 23-спирали, и вообще как программная произвольная форма.



Пикотехнология белков, ДНК, РНК - 3

Ищем 48 символов D подряд

https://blast.ncbi.nlm.nih.gov

Нашёлся единственный(!) белок:

https://www.ncbi.nlm.nih.gov/protein/10 … CT76DGC016

https://www.ncbi.nlm.nih.gov/nuccore/1039188425

>ENA|OBQ31849|complement 529 nucleotides
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgacgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatg


https://img-fotki.yandex.ru/get/177902/158289418.400/0_178542_5f21e856_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.400/0_178546_88b12942_orig.png

https://img-fotki.yandex.ru/get/114207/158289418.400/0_178543_40892484_orig.png

https://img-fotki.yandex.ru/get/25921/158289418.400/0_178544_d8b4b87c_orig.png

https://img-fotki.yandex.ru/get/177902/158289418.400/0_178545_e55239b_orig.png

https://img-fotki.yandex.ru/get/194835/158289418.400/0_178547_7f261108_orig.png

Кушелев: Интересно, зачем нужен такой экзотический белок? Сверхдлинная пи-спираль с одним изломом.